УДК 636.52/58:575.113/118

ГЕНЕТИЧЕСКОЕ РАЗНООБРАЗИЕ СТРАУСОВ ПО МИКРОСАТЕЛЛИТНЫМ МАРКЕРАМ

Осадчая Юлия Васильевна
Национальный университет биоресурсов и природопользования Украины
кандидат сельскохозяйственных наук, доцент кафедры генетики, разведения и биотехнологии им. Н.А. Кравченка

Аннотация
Обобщены литературные данные по генетическому разнообразию трех подвидов страусов с целью подтверждения их принадлежности к различным подвидам. Исследования были проведены на страусах североафриканского черношейного (n = 30), зимбабвийского голубошейного (n = 32) и кенийского красношейного (n = 17) подвидов с использованием 19 микросателлитных локусов. Определяли фактическую и ожидаемую гетерозиготность, а также генетическое расстояние по Нею. Установлены существенные различия между тремя подвидами страусов. Черношейные и голубошейные страусы были генетически ближе (FST = 0,10 и Nei = 0,49), тогда как генетическое расстояние между голубошейными и красношейными было несколько дальше (FST = 0,13 и Nei = 0,61). Черношейные страусы характеризовались высокой гетерозиготностью (Ho = 0,72) в пределах своей популяции, тогда как голубошейные и красношейные - низкой (Ho = 0,68). Основываясь на этих результатах, было отмечено, что скрещивание между этими подвидами страусов приведет к гетерозису.

Ключевые слова: страусы


OSTRICHES GENETIC DIVERSITY AT THE MICROSATELLITE MARKERS

Osadchaya Julia Vasilievna
National University of Life and Environmental Sciences of Ukraine
PhD in Agricultural Sciences, Assistant Professor of Genetics, Breeding and Animal Biotechnology them N.A. Kravchenko

Abstract
Genetic diversity within and among three ostrich populations was investigated to corroborate whether these populations can be classified genetically as three different breeds. The DNA of South African Black (n = 30), Zimbabwean Blue (n = 32) and Kenyan Redneck (KR, n=17) birds was assessed for genetic differences using 19 microsatellite loci. The number of alleles, as well as observed and expected heterozygosity of alleles, was determined. Genetic differentiation was measured using the F-statistic (FST) and Nei’s genetic distance. Significant differences were observed among the three breeds. The SAB and ZB (FST=0.10 and Nei=0.49) were genetically more similar, whereas the genetic distance between the KR and ZB breeds was the greatest (FST= 0.13 and Nei=0.61). The SAB strain exhibited the greatest observed heterozygosity (Ho=0.72) within its population while the ZB and the KR exhibited lower levels of heterozygosity (Ho=0.68). Based on these results, it was suggested that crossbreeding between these breeds would lead to heterosis in commercial ostrich enterprises.

Рубрика: Общая рубрика

Библиографическая ссылка на статью:
Осадчая Ю.В. Генетическое разнообразие страусов по микросателлитным маркерам // Исследования в области естественных наук. 2015. № 4 [Электронный ресурс]. URL: http://science.snauka.ru/2015/04/9694 (дата обращения: 02.05.2017).

Введение. Тремя подвидами страусов, которые в настоящее время составляют генофонд Южно-Африканской республики является южно-африканский черношейный, зимбабвийский голубошейный и кенийский красношейный. Южно-Африканский черношейный подвид страусов был создан с целью улучшения перьевой продуктивности в начале 1900-х годов [11]. Голубошейные и красношейные страусы характеризуются высоким живым весом по сравнению с черношейными. Живой вес голубошейных  страусов в среднем составляет 125 кг, красношейных - 135 кг, а черношейных лишь 115 кг [19]. Что касается репродуктивной способности, то низкие показатели характерны для голубошейных страусов [5,7]. В основном эти подвиды скрещивались хаотично без соответствующей цели разведения. О результатах таких скрещиваний отсутствуют любые научные данные [28].

Наиболее многочисленным подвидом страусов, который используется в сельском хозяйстве, является черношейный. Однако этот подвид характеризуется низкой репродуктивной способностью, хотя и высшей, нежели у других подвидов, а также сохранностью страусят [7]. Воспроизводительная способность и сохранность страусят могут быть улучшены за счет эксплуатации неадитивной генетической изменчивости, выраженной гибридной силой скрещивания (гетерозисом). Однако гетерозис может быть получен только при условии, что выбранные для скрещивания подвиды страусов, генетически отличаются друг от друга. Поэтому важно подтвердить это генетическую расстояние между тремя подвидами страусов [10]. Различные подвиды страусов характеризуются различными физическими характеристиками, которые указывают на их генетическую дифференциацию [19]. Однако, в какой мере эти фенотипические различия являются результатом воздействия генетических факторов, а не влиянием окружающей среды, до сих пор не было изучено.

Генетическая дифференциация субпопуляций может быть определена с использованием генетических маркеров, в том числе и микросателлитов. Микросателлиты широко используются в исследованиях генетического разнообразия птицы, а также других видов животных [23,24,25,34,35]. Используют различные молекулярные маркеры для изучения генетического разнообразия между субпопуляциями страусов. Эти маркеры включают полиморфизм длины рестрикционных фрагментов (ПДРФ) [14], минисателлиты [20] и микросателлиты [22]. Генетические различия были обнаружены между голубошейными и красношейными страусами [22] и между черношейными, голубошейными и красношейными [20] с использованием ПДРФ-маркеров и микросателлитов соответственно. Однако эти результаты были получены на слишком маленьких популяциях страусов,  оцененных только по пяти микросателитным локусам. Поэтому эти результаты требуют подтверждения на больших выборках с использованием большего количества микросателлитных локусов, поскольку такое их количество может быть неинформативным. Микросателлиты также были использованы для построения генетической карты страусов [18]. Эта карта может быть использована для будущей идентификации хромосомных районов ассоциированных с количественными признаками, такими как яйценоскость, мясная продуктивность, репродуктивная способность, резистентность к заболеваниям.

Генетическая дифференциация между популяциями, а также внутри них, может быть измерена с помощью F-статистики (FST) [16,17]. F-статистика напрямую связана с дисперсией частоты аллелей в середине популяции и степени родства между отдельными особями [17]. Поэтому скрещивание черношейных, голубошейных и красношейных страусов может привести к гетерозису, а следовательно, улучшению их хозяйственно полезных признаков.

Целью данной работы является анализ литературных данных о генетических различий трех подвидов страусов для дальнейшего поиска наиболее удачных комбинаций и получения максимального уровня гетерозиса.

Материал и методы исследований. Для проведения исследований учеными были отобраны образцы крови черношейных (n=30), голубошейных (n=32) и красношейных (n=17) страусов которых разводили в Аутдорфе. После отбора образцы крови хранили при температуре 4 °С [13], а затем в лаборатории при -18 °С [9].

Кровь у страусов отбирали из вены крыла по 2 мл. в пробирки Vacutainer ™ K2EDTA. ДНК очищали согласно методике [31].

Концентрацию ДНК определяли методом спектрофотометрии и электрофореза в агарозном геле. Полимеразную цепную реакцию (ПЦР) проводили в конечном объеме 5 мкл, состоящим из 20 нг матричной ДНК и 0,4-0,6 ммоль каждого праймера с KAPA 2G Fast Hotstart Readymix (KAPA Biosystems ™). Праймеры были замечены PET®, 6-FAM ™, NED ™ и VIC® флуоресцентными красителями, поставляемых Applied Biosystems®. Условия ПЦР для KAPA 2G были денатурация при 95 °С в течение трех минут, а затем 40 циклов денатурации при 95 °С в течение 15 секунд, отжиг при 72 °С в течение 15 секунд, а относительное удлинение при 72 °С в течение пяти секунд, заканчивая один цикл для конечного удлинения при 72 °С в течение 10 минут.

Анализ ученые проводили по 23 микросателитным локусам, ранее описанным в литературе (табл. 1). Последовательность строения микросателлитных праймеров также была ранее описана рядом авторов [18,20,21,32]. Люминесцентные ПЦР-продукты подвергали электрофорезу с использованием генетического анализатора 3130xl (Applied Biosystems®) в университете Стелленбош. Аллели быть заданы с помощью ABI Prism® Genemapper программного обеспечения Version 4.0 (Applied Biosystems®).

  1. Микросателлитные локусы

Маркер

Тм

Последовательность

Красители

Алели

Повторы

Ссылки

CAU3 58,5 F: AACTAAGTATAGCCCTGTTACA

R: TGCGAGTCTTTCTAGTTCTAC

VIC 6 (CA)9

Tang et al.,

2003

CAU14

 

58,5 F: ATTTAACTTCTCTAAGGCACTC

R: GAGGAGCAATTCAGACAGAC

6-FAM 14 (CA)16
CAU17 58,5 F: CGTAAACCCAGATAATCACAA

R: AGTGGCATTGTAGCTCTTCA

NED 11 (CA)22
CAU42 61,5 F: AGTCCAGCCCGCATACAC

R: CCTCTGTGGAGAGAACTGTGTG

PET 7 (CA)10
CAU83 68,5 F: AAACAAGCCGCTAGTGAGGA

R: TGCAGACTCAGACCAGCATC

PET 8 (AC)16
CAU85 60,5 F: GAGGTGCCTGTCTTGTTTAC

R: AAAAGCACCTTCCCACATTG

NED 16 (AC)26
CAU128 64,9 F: TAAACACAAACAGACACAGAC

R: TAACTTTGTGGCAACCAGTAG

6-FAM 4 (AC)11

Huang et al.,

2008

CAU129 67,9 F: GGCACAATTTCCTACCAAGC

R: GGGACTGATGCTGTCTGGTT

PET 11 (AC)22
CAU131 64,9 F: CCAATTCCGTGCATATGTGT

R: TGTCAGGTGTTTCTGCATCA

VIC 10 (CA)20
CAU133 60,7 F:GGAAGATCCTTGCTGTTGGT

R: TGGACTGTTATCTGGCGATG

6-FAM 7 (CA)15
CAU144 60,7 F: ATATGCATGTGAGTATAAACAC

R: CTGGGGAGCAGAGTCACC

PET 10 (AC)17
LIST005 55 F: ATGGTGCTTTCCAGTGGTGTGC

R:

6-FAM 10 (TG)2CG(TG)10

Kumari &

Kemp, 1998

LIST009 55 F: CATTGCAAACACTCTGCTGC

R: TGAACGACAGGGTTATTGGC

6-FAM 13 (CA)14CG(CA)3CG(CA)3
LIST0011 58 F: ACTGAAGTTTCCTTCTCCCC

R: TTCCTGAAGCAACCACAC

PET 10 (GT)24
OSM1 57 F: AATCTGCCTGCAAAGACCAG

R: TCCCAGTCTTGAAGTCAGCA

6-FAM 9 (CA)17

Kimwele

et al., 1998

OSM2 57 F: AAGCCACGGCAATGAATAAG

R: CCTCAACCATTCTGTGATTCTG

NED 6 (CA)22
OSM3 57 F: ATCTCCTTTGCTGGTGCAAT

R: CCGGGGGGATTTCTTATGT

VIC 4 (CA)15
OSM4 56 F: ATCACTTTGCTGAAGTCAAAGG

R: CTAACAGAGATCTGGGCGGA

PET 5 (CA)16
OSM5 59 F: GTGGATCAGTTCAATCCTTGC

R: GCCCAAGAAAATGATGGAGA

NED 6 (CA)20
OSM7 58 F: AGCATACACATGCAGACCCC

R: TGTTTCCTGCCATTCTGTCA

VIC 7 (CA)16CT(CA)5CT(CA)25
VIAS-OS4 53,7 F: CTCCTGGATGTTCTAGCAGT

R: CTCCTTGTCCAGCCATATAC

VIC 12 (GTGTAT)2(GT)9

Kawka et al.,

2007

VIAS-0S14 49,9 F: CACTTCTCCGAATTTTAAAAGG

R: AGGAAGAGATGTGGAGTCCC

6-FAM 18 (AC)21
VIAS-OS29 55,1 F: TTTTCGTCTTCCACCCACTG

R: CTGCTTCTTCCGTGTGTGTC

PET 18 (AC)13GG(AC)6GG(AC)4

Амплификация была успешной для 21 микросателлитного локуса с 23 протестированных на начальном этапе. CAU42 и LIST0011 не удалось амплифицировать поэтому они были исключены из дальнейшего анализа. CAU133 и VIAS-0S14 были исключены из анализа, поскольку оказались мономорфными. Поэтому осталось 19 микросателлитных локусов, подлежащих к дальнейшему исследованию. Информация об этих локусах приведена в таблице 2.

19 микросателлитных локуса были проверены на нулевые аллели с использованием программного обеспечения Microchecker version 2.2.3 [33]. После этой проверки  их оценивали с использованием FST-outlier метода [2], который проводили Lositan Version 1 [1]. Genetix version 4.0.5.2 была использована для проверки количества аллелей, а также фактической и ожидаемой гетерозиготности [3].

Генотип и аллельные частоты оценивали с использованием программного обеспечения GDA Version 1.1 [35]. Анализ микросателлитов [27] был использован для определения среднего количества аллелей, фактической и ожидаемой гетерозиготности и индекса фиксации с соответствующими стандартными отклонениями для каждой субпопуляции. Индекс фиксации (FI) является мерой избытка гомозиготности в популяции и взаимосвязан с коэффициентом инбридинга [15]. Генетическая дифференциация была определена в условиях попарных значений FST, рассчитанных с использованием Genetix Version 4.0.5.2 [3]. Генетическое расстояние Нея [26] рассчитано с использованием программного обеспечения GENEPOP 4.0 [30].

Результаты исследований. Все 19 локусов, использованные в исследованиях оказались полиморфными (табл. 2). По маркеру CAU85 наблюдали 28 аллелей, тогда как по данным других исследований только 16 [32]. Микросателитный локус LIST009 характеризовался 27 аллелями, по сравнению с 13 указанными исследователями ранее [22]. По локусу OSM7 было отмечено 24 аллеля, по сравнению с 7 указанными в литературе [21]. Эти различия в количестве аллелей могут быть обусловлены меньшим количеством циклов ПЦР или из-за возможных мутации, возникающих в этих локусах [4].

Генетическое разнообразие может быть описано с помощью среднего числа аллелей на локус, а также средней фактической и ожидаемой гетерозиготности этих аллелей. В общей сложности ученые наблюдали 263 аллели в трех подвидов страусов. Среднее число аллелей на локус - 13,8 (табл. 2). Ожидаемая гетерозиготность составляла 0,81, а фактическая - 0,69 для всех локусов всех трех подвидов страусов, что свидетельствует об их значительном генетическом разнообразии.

2. Результаты исследования микросателлитных локусов

Маркеры

Аллели

Размер

Гетерозиготность

Индекс фиксации

фактический

ожидаемый

ожидаемая

фактическая

CAU3

CAU14

CAU17

CAU83

CAU85

CAU128

CAU131

CAU133

CAU144

LIST005

LIST009

OSM1

OSM2

OSM3

OSM4

OSM7

VIAS-0S4

VIAS-OS14

VIAS-0S29

5

10

12

8

28

8

12

4

9

16

27

16

17

7

13

24

14

16

17

120

155

197

217

287

223

120

196

166

224

328

141

187

152

159

241

272

243

155

125

178

180

218

276

231

125

201

167

197

199

110

121

232

134

215

268

245

173

0,67

0,85

0,86

0,76

0,95

0,61

0,81

0,71

0,74

0,88

0,94

0,84

0,90

0,59

0,83

0,93

0,80

0,88

0,89

0,63

0,83

0,72

0,58

0,92

0,61

0,72

0,71

0,45

0,63

0,80

0,80

0,66

0,58

0,55

0,89

0,53

0,74

0,88

0,07

0,03

0,20

0,30

0,03

0,01

0,11

0,01

0,40

0,30

0,20

0,06

0,30

0,03

0,3

0,04

0,3

0,2

0,01

В среднем

13,8 ± 1,6

-

-

0,81 ± 0,2

0,69 ± 0,03

0,15 ± 0,03

Всего

263

-

-

-

-

-

Среднее число аллелей у черношейных страусов составляло 8,8, у голубошейных - 9,4 и в красношейных - 6,2. В среднем по всем трем подвидах страусов среднее число аллелей равнялось 8,1.

Фактическая гетерозиготность составляла 0,69, а ожидаемая 0,74 (табл. 3). Фактическая гетерозиготность была наивысшей у черношейных страусов  - 0,72 ± 0,019 по сравнению с голубошейными (0,68 ± 0,019) и красношейными (0,69 ± 0,026). Полученные учеными результаты согласуются с данными Kawka и др. [20], который установил, что высокий уровень фактической гетерозиготности характерен для черношейных страусов, а низкий - для красношейных. Это можно объяснить тем, что черношейные страусы являются искусственно созданным подвидом. Он был создан фермерами ЮАР (ЮАР) путем скрещивания страусов Южно-африканского (S. С. Australis) с Арабским и Северо-африканского подвидов (S. С. Camelus), разведением гибридов "в себе" и селекции на улучшение качества перьев [11]. Латинское название черношейного подвида страусов - Struthio camelus domesticus. Южноафриканские фермеры называют этот подвид страусов Африканской черной породой и разводят на фермах для производства мяса, кожи, перьев и другого сырья.

Голубошейными называют Южно-африканских (S. С. Australis) и Сомалийских (S. С. Molybdophanes) страусов, а красношейными - Северо-африканских (S. С. Camelus) и Масайских (S. С. Massaicus) подвиды. Эти подвиды страусов являются естественными [6].

Индекс фиксации страусов в исследованиях ученых составляет в черношейных страусов - 0,05, у голубошейных - 0,13 и у красношейных - 0,01 (табл. 3). Самый высокий индекс фиксации был присущ голубошейным страусам (Fi = 0,13), что свидетельствует о тесной степени родства между индивидами в рамках этого подвида. У красношейных страусов индекс фиксации был низким (Fi = 0,01), что свидетельствует об ограниченном уровне инбридинга в пределах этого подвида.

3. Среднее число аллелей, гетерозиготность и индекс фиксации страусов трех подвидов

Подвид страусов

Аллели

Гетерозиготность

Индекс фиксации

ожидаемая

фактическая

Черношейный

Голубошейный

Красношейный

8,8 ± 4,06

9,4 ± 3,96

6,2 ± 2,29

0,75 ± 0,030

0,78 ± 0,034

0,69 ± 0,024

0,72 ± 0,019

0,68 ± 0,019

0,69 ± 0,026

0,05

0,13

0,01

В среднем

8,1

0,74

0,69

0,07

Значительные различия наблюдались в отношении генетического сходства между тремя подвидами страусов (табл. 4). Черношейные и голубошейные страусы оказались более похожими друг на друга. FST между ними составляло 0,10, а генетическое расстояние Нея - 0,49 при P <0,05.

4. Среднее стандартное генетическое расстояние за Неем и значение F-статистики для страусов трех подвидов

Подвиды страусов

Генетическое расстояние за Неем

F-статистика

Черношейные и голубошейные

Черношейные и красношейные

Голубошейные и красношейные

0,49 (P<0,05)

0,51 (P<0,05)

0,61 (P<0,05)

0,10 (P<0,05)

0,12 (P<0,05)

0,13 (P<0,05)

Наибольшее генетическое расстояние было установлено ​​между голубошейными и красношейными страусами - 0,61 (P <0,05). Этот результат был несколько неожиданным, поскольку географически эти два подвида имеют близкое расположение, по сравнению с черношейными и красношейными. Согласно данным других авторов [20], наибольшее генетическое расстояние характерно для черношейных и красношейных подвидов страусов, и значительно меньше между голубошейными и красношейными.

Значение F-статистики для всех трех подвидов страусов приближалось к нулю, что свидетельствует об аналогичной дисперсии частот аллелей в них [16,17]. Все значения F-статистики попадают в диапазон от 0,05 до 0,15, интерпретирующийся как умеренная генетическая дифференциация между подвидами [16], тогда как дисперсия частот аллелей между подвидами несколько отличалась.

Выводы. Исследования многих ученых показали значительную генетическую дифференциацию между тремя подвидами страусов. Высоким уровнем генетической изменчивости характеризуются черношейные страусы, что обеспечивает высокие возможности их генетического улучшения.

Голубошейные и красношейные подвиды страусов характеризовались низким генетическим разнообразием. В то же время, высокая ожидаемая гомозиготность этих подвидов может быть использована в скрещиваниях для получения эффекта гетерозиса.

Генетические различия, полученные для трех подвидов страусов, служат подтверждением их фенотипических различий исследованных другими учеными [19]. Применение этих знаний может быть использовано для разработки коммерческих программ скрещивания страусов на основе научных принципов.


Библиографический список
  1. Antao T. A workbench to detect molecular adaptation based on Fst outlier method / Antao T., Lopes A., Lopes R.J., Beja-Pereira A. & Luikart G. // BMC Bioinform. – 2008. – Vol. 9. – 323 p.
  2. Beaumont M.A. Evaluating loci for use in genetic analysis of population structure / Beaumont M.A., Nichols R.A. // Proc. R. Soc. Lond. B. – 1996. – Vol. 263. – P. 1619-1626.
  3. Belkhir K. GENETIX 4.0.5.2., Software under windows™ for the genetics of populations / Belkhir K., Borsa P., Chikhi L., Raufaste N. & Bonhomme F. // Laboratory Genome, Populations, Interaction, CNRS UMR 5000, University of Montpellier II, Montpellier (France), 2004. – 589 p.
  4. Beuzen N.D. Molecular markers and their use in animal breeding / Beuzen N.D., Stear M.J. & Chang K.C. //  Vet. J. – 2000. – Vol. 160. – P. 42-52.
  5. Brand M.M. A comparison of live weights, body measurement and reproductive traits in Zimbabwean Blue Ostriches (Struthio camelus australis) and South African Black Ostriches (S. camelus var. domesticus) /  Brand M.M., Cloete S.W.P., Hoffman L.C. & Muller M. // Proc. 3rd Int. Ratite Sci. Symp. XII World Ostrich Cong. Madrid, Spain. – 14-16 October 2005.  – P. 73-80.
  6. Bunter K. The genetic analysis of reproduction and production traits recorded for farmed ostriches (Struthio camelus) / Bunter K. // Ph.D dissertation, University of New England, Armidale NSW, Australia. – 2002.
  7. Cloete S.W.P. Factors related to high levels of ostrich chick mortality from hatching to 90 days of age in an intensive rearing system / Cloete S.W.P., Lambrechts H., Punt K. & Brand Z. // J. S. Afr. Vet. Assoc. – 2001. – Vol. 72. – P. 197-202.
  8. Cloete S.W.P. Direct responses in breeding values to selection of ostriches for live weight and reproduction / Cloete S.W.P., Brand Z., Bunter K.L. & Malecki I.A., Aust. J. Exp. Agric. – 2008. – Vol.  48. – P. 1314-1319.
  9. Cloete S.W.P. Live weight and reproduction performance of Zimbabwean Blue and South African Black ostriches / Cloete S.W.P., Brand M.M., Hoffman L.C. & Muller M. // S. Afr. J. Anim. Sci. – 2008. – Vol. 38. – P. 65-73.
  10. Dalton D.C. An Introduction to Practical Animal Breeding /  Dalton D.C. // Granada Publ. London. –  1981. –  P. 128-142.
  11. Duerden J.E. Crossing the North African and South African ostrich / Duerden J.E.  //  J. Gen. – 1913.  – Vol. 8. –  P. 155-198.
  12. Engelbrecht A. Direct heterosis for liveweight and chick mortality in ostriches / Engelbrecht A., Cloete S.W.P. & Van Wyk J.B. //  Aust. J. Exp. Agric. – 2008. – Vol. 48. – P. 1320-1325.
  13. Essa F. Parentage determination of ostriches in breeding flocks using microsatellite markers / Essa F., Cloete S.W.P. & Fossey A.  // Proc. 3rd Int. Ratite. Sci. Symp. XII World Ostrich Cong. Madrid, Spain, 14th-16th October. 2005. – P. 29-33.
  14. Freitag  S. Phylogeographic patterns in the mitochondrial DNA of the ostrich (Struthio camelus) / Freitag  S. & Robinson, T.J. // The Auk. – 1993. – Vol. 110. – P. 614-622.
  15. Hamilton M.B. Population genetics. Wiley Blackwell / Hamilton M.B.  // Publ. The Atrium, Southern Gate, West Sussex, United Kingdom. – 2009. – P. 34.
  16. Hartl D.L. Principles of Population Genetics / Hartl D.L. & Clark A.G., // 3rd ed. Sinauer Associates, Inc. Publ. Sunderland, Massachusetts. – 1997. – P. 135-145.
  17. Holsinger K.E.  Genetics in geographically structured populations: defining, estimating and interpreting / Holsinger K.E. & Weir B.S. //  Fst. Nat. Rev. Genet. – 2009.  – Vol. 10. – P. 639-650.
  18. Huang Y. A preliminary microsatellite genetic map of the Ostrich (Struthio camelus) / Huang Y., Liu Q., Tang B., Lin L., Liu W., Zhang L., Li N. & Hu X., //  Cytogenet. Genome Res. – 2008. – Vol. 121. – P. 130-136.
  19. Jarvis M.J.F., The subspecies and races of ostriches and their present status in the wild /  Jarvis M.J.F. // Proc. 2nd Int. Ratite Cong., Oudtshoorn, South Africa, 21-25 September 1998. –  P. 4-8.
  20. Kawka M. Genetic characteristics of the ostrich population using molecular methods / Kawka M., Horbanczuk J.O., Sacharczuk M., Ziba G., Łukaszewicz M., Jaszczak K. & Parada R. // Poult. Sci. – 2007. – Vol. 86. – P. 277-281.
  21. Kimwele C.N. Development of microsatellite markers for parentage typing of chicks in the Ostrich (Struthio camelus) /  Kimwele C.N., Graves J.A., Burke T. & Hanotte O.  // Mol. Ecol. – 1998. – Vol. 7. – P. 247-25.
  22. Kumari P. Polymorphic microsatellite markers in the ostrich (Struthio camelus) / Kumari P. & Kemp S.J. //  Mol. Ecol. – 1998. – Vol. 7. – P. 133-140.
  23. Li S.J. Genetic diversity analyses of 10 indigenous Chinese pig populations based on 20 microsatellites /  Li S.J., Yang S.H., Zhao S.H., Fan B., Yu M., Wang H.S., Li M.H., Liu B., Xiong T.A. & Li K. // J. Anim. Sci. – 2004. – Vol.  82. – P. 368-374.
  24. Mtileni B.J. Genetic diversity and conservation of South African indigenous chicken populations / Mtileni B.J., Muchadeyi F.C., Maiwashe A., Groeneveld E., Groeneveld L.F., Dzama K. & Weigend S. //  J. Anim. Breed. Genet. – 2011.  – Vol. 128. – P. 209-218.
  25. Muchadeyi F.C. Assessment of genetic diversity of Zimbabwe village chicken eco-types / Muchadeyi F.C. // PhD dissertation for Agricultural Sciences in Gottingen (IPAG), Georg-August Univesitat, Germany, 2007.
  26. Nei M. Genetic distance between populations / Nei M. // Am. Nat. – 1972. – Vol. 106. – P. 283-292.
  27. Park S.D.E. Trypanotolerance in Western African cattle and the population genetic effects of selection / Park S.D.E.  //  Ph.D. Genetic Department, University of Dublin, Ireland, 2001.
  28. Petite J.M. Breeding and Genetics / Petite J.M. & Davis G. // In: The Ostrich: Biology, Production and Health. Ed. – 1999. – 584 p.
  29. Deeming D.C. CABI / Deeming D.C. // Publ. CAB Int. Wallingford, Oxon, United Kingdom . –  2008. – P. 275-292.
  30. Raymond M. Genepop (Version 1.2): Population genetics software for exact test and ecumenicism / Raymond M. & Rousset F.  //  J. Hered. – 1995. – Vol.  86. – P. 248-249.
  31. Sambrook J. Molecular Cloning: A Laboratory Manual / Sambrook J. & Russell D.W. // Cold Spring Harbor Laboratory, New York, USA, 2001.
  32. Tang B. Isolation and characterization of 70 novel microsatellite markers from ostrich (Struthio camelus) genome / Tang B., Huang Y., Lin L., Hu X., Feng D., Yao P., Zhang L. & Li N. // Genome. – 2003.  – Vol. 46. – P. 833-840.
  33. Oosterhout C. VMICRO-CHECKER: software for identifying and correcting genotyping errors in microsatellite data / Oosterhout C., Hutchinson W.E., Wills D.P.M. & Shipley P. // Mol. Ecol. Notes. – 2004. – Vol. 4. – P. 535-538.
  34. Vicente A.A. Genetic diversity in native and commercial breeds of pigs in Portugal assessed by microsatellites / Vicente A.A., Carolina M.I., Sousa M.C.O., Ginja C., Silva F.S., Martinez A.M., Vega-Pla J.L., Carolina N. & Gama L.T. //  J. Anim. Sci.  – 2008.  – Vol. 86. – P. 2496-2507.
  35. Weir B.S. Genetic Data Analysis II / Weir B.S. // Sinauer, Sunderland, Massachusetts, USA, 1996. – 478 p.
  36. Zhou G. Genetic diversity analysis of five cattle breeds native to China using microsatellites / Zhou G., Jin H., Zhu Q., Guo S. & Wu Y. // J. Genet. – 2005. – Vol. 84. – P. 77-80.


Все статьи автора «Осадчая Юлия Васильевна»


© Если вы обнаружили нарушение авторских или смежных прав, пожалуйста, незамедлительно сообщите нам об этом по электронной почте или через форму обратной связи.

Связь с автором (комментарии/рецензии к статье)

Оставить комментарий

Вы должны авторизоваться, чтобы оставить комментарий.

Если Вы еще не зарегистрированы на сайте, то Вам необходимо зарегистрироваться: